ID: 946702112_946702124

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 946702112 946702124
Species Human (GRCh38) Human (GRCh38)
Location 2:222424495-222424517 2:222424516-222424538
Sequence CCTCCGCCCGGAGTGCGGGATCG CGGCGGGGGCGAGGCGGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 43} {0: 1, 1: 0, 2: 10, 3: 162, 4: 1188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!