ID: 947197371_947197374

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 947197371 947197374
Species Human (GRCh38) Human (GRCh38)
Location 2:227582438-227582460 2:227582479-227582501
Sequence CCATGCTTGTATAGCCTACAGAA TGTTTATAAATACCAGTCCCAGG
Strand - +
Off-target summary {0: 4, 1: 57, 2: 402, 3: 494, 4: 492} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!