ID: 947718166_947718178

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 947718166 947718178
Species Human (GRCh38) Human (GRCh38)
Location 2:232352128-232352150 2:232352154-232352176
Sequence CCAAACTTGGGTGAAGTTTCACC TCGCGGGGCGCGGGCTGGCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 28, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!