ID: 947745186_947745206

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 947745186 947745206
Species Human (GRCh38) Human (GRCh38)
Location 2:232503608-232503630 2:232503656-232503678
Sequence CCCCTCTTTACCCTCGCTTCCCC ATTCCCGAGCCCGGGGAGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 20, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!