ID: 947856257_947856270

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 947856257 947856270
Species Human (GRCh38) Human (GRCh38)
Location 2:233326614-233326636 2:233326662-233326684
Sequence CCGCACTGGGTGCCTTGCTGCCT GCAGGTGACCATGGGGGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 376} {0: 1, 1: 1, 2: 2, 3: 28, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!