ID: 947856259_947856263

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 947856259 947856263
Species Human (GRCh38) Human (GRCh38)
Location 2:233326626-233326648 2:233326644-233326666
Sequence CCTTGCTGCCTGGCCACATGAGG TGAGGCTGCCGCTGAACAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 287} {0: 1, 1: 0, 2: 1, 3: 19, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!