ID: 947920462_947920471

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 947920462 947920471
Species Human (GRCh38) Human (GRCh38)
Location 2:233866915-233866937 2:233866966-233866988
Sequence CCATCCACCATCTCCTTACAAAG GGCACGTTCATGCTGGCATGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 7, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!