|
Left Crispr |
Right Crispr |
| Crispr ID |
948247613 |
948247622 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:236499579-236499601
|
2:236499623-236499645
|
| Sequence |
CCACCACCTCAGGCTAATTTTTG |
TTTCACCACACTGGCCAGGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 190, 2: 6028, 3: 63575, 4: 186837} |
{0: 86, 1: 2505, 2: 20744, 3: 122080, 4: 164588} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|