ID: 948607576_948607582

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 948607576 948607582
Species Human (GRCh38) Human (GRCh38)
Location 2:239145980-239146002 2:239146014-239146036
Sequence CCCAGAGAAACCAGAGAGGCGCT CCAGACTCTAAGCCTCTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 133} {0: 1, 1: 0, 2: 1, 3: 27, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!