ID: 948781448_948781464

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 948781448 948781464
Species Human (GRCh38) Human (GRCh38)
Location 2:240324206-240324228 2:240324258-240324280
Sequence CCATCCATCACAGTCCCCACATC GCAGCTCCTCCATGCCCTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 318} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!