ID: 948811673_948811679

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 948811673 948811679
Species Human (GRCh38) Human (GRCh38)
Location 2:240481579-240481601 2:240481599-240481621
Sequence CCTCTCCATCACCTCGATGGGTT GTTGCTCAGGGTTTATGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97} {0: 1, 1: 0, 2: 1, 3: 11, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!