ID: 949022694_949022708

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 949022694 949022708
Species Human (GRCh38) Human (GRCh38)
Location 2:241750374-241750396 2:241750397-241750419
Sequence CCGGGTGGGCGGGGGGTGCCCGG GCGGGCGGGTGGGGGGTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 451} {0: 1, 1: 1, 2: 4, 3: 67, 4: 610}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!