ID: 949022694_949022711

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 949022694 949022711
Species Human (GRCh38) Human (GRCh38)
Location 2:241750374-241750396 2:241750408-241750430
Sequence CCGGGTGGGCGGGGGGTGCCCGG GGGGGTCCCTGGGCGGAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 451} {0: 1, 1: 0, 2: 2, 3: 35, 4: 395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!