ID: 949417593_949417595

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 949417593 949417595
Species Human (GRCh38) Human (GRCh38)
Location 3:3830885-3830907 3:3830912-3830934
Sequence CCAAGAGCTGTCTCTCAAAAGGA AGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 181, 1: 197, 2: 163, 3: 130, 4: 293} {0: 185, 1: 187, 2: 104, 3: 111, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!