ID: 949670939_949670943

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 949670939 949670943
Species Human (GRCh38) Human (GRCh38)
Location 3:6398591-6398613 3:6398611-6398633
Sequence CCCCTTCTAATTCACTCTTAGCG GCGGCAAGTCCCGCTTTTGTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!