|
Left Crispr |
Right Crispr |
| Crispr ID |
949769961 |
949769971 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:7568629-7568651
|
3:7568675-7568697
|
| Sequence |
CCGGCGCTTGCGGGCCAGCTGGA |
GGCCCAGCACTCAGAGCAGCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 13, 1: 7, 2: 9, 3: 26, 4: 121} |
{0: 5, 1: 48, 2: 336, 3: 459, 4: 824} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|