ID: 949878326_949878337

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 949878326 949878337
Species Human (GRCh38) Human (GRCh38)
Location 3:8641640-8641662 3:8641674-8641696
Sequence CCAGATGGGCCCCTAGAGGCCAG CTGGGAAAGCTGCATTCCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 207} {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!