ID: 950043238_950043249

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 950043238 950043249
Species Human (GRCh38) Human (GRCh38)
Location 3:9933503-9933525 3:9933528-9933550
Sequence CCTGGATAGCTACTTCCATCCCC GGGACTCCCGCGCCGGGACGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 130} {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!