ID: 950043242_950043257

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 950043242 950043257
Species Human (GRCh38) Human (GRCh38)
Location 3:9933518-9933540 3:9933540-9933562
Sequence CCATCCCCCGGGGACTCCCGCGC CCGGGACGCGGGGTGGGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 210} {0: 1, 1: 0, 2: 1, 3: 25, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!