|
Left Crispr |
Right Crispr |
| Crispr ID |
950383011 |
950383015 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:12633444-12633466
|
3:12633461-12633483
|
| Sequence |
CCACACTCCAGCTTGGGCAACAG |
CAACAGAGGGAGACCCTGTCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 42, 1: 1671, 2: 4140, 3: 6233, 4: 7349} |
{0: 3, 1: 32, 2: 126, 3: 364, 4: 769} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|