ID: 950420964_950420973

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 950420964 950420973
Species Human (GRCh38) Human (GRCh38)
Location 3:12899296-12899318 3:12899332-12899354
Sequence CCCCGCGGCCCGCAGAGTCAGGC TTTCTGAAAGGGCCTCCGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 94} {0: 1, 1: 0, 2: 0, 3: 3, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!