ID: 950420968_950420978

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 950420968 950420978
Species Human (GRCh38) Human (GRCh38)
Location 3:12899305-12899327 3:12899344-12899366
Sequence CCGCAGAGTCAGGCGTGAGCTTC CCTCCGCCTGGGCAGGCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 120} {0: 1, 1: 0, 2: 2, 3: 31, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!