ID: 950420977_950420985

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 950420977 950420985
Species Human (GRCh38) Human (GRCh38)
Location 3:12899344-12899366 3:12899358-12899380
Sequence CCTCCGCCTGGGCAGGCGCCGGG GGCGCCGGGGGGCAGTCCTCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 31, 4: 880} {0: 1, 1: 0, 2: 0, 3: 13, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!