ID: 950798470_950798473

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 950798470 950798473
Species Human (GRCh38) Human (GRCh38)
Location 3:15530518-15530540 3:15530542-15530564
Sequence CCCTGTCTTCTTCTGATGGAATG TGTTGCTTCTCCTTGAGAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 11, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!