|
Left Crispr |
Right Crispr |
| Crispr ID |
951003616 |
951003620 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:17592822-17592844
|
3:17592861-17592883
|
| Sequence |
CCTGCCATCTTCTGTAGATAACT |
ACAGCTTTTGGCCTGTTACTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 197, 2: 196, 3: 113, 4: 220} |
{0: 13, 1: 197, 2: 200, 3: 155, 4: 240} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|