|
Left Crispr |
Right Crispr |
Crispr ID |
951016252 |
951016256 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:17735765-17735787
|
3:17735811-17735833
|
Sequence |
CCTGCTGGATCTGGAGGGGTGGA |
CAGCAAACAGCAGTGGTGGATGG |
Strand |
- |
+ |
Off-target summary |
{0: 15, 1: 48, 2: 81, 3: 158, 4: 318} |
{0: 29, 1: 90, 2: 112, 3: 84, 4: 319} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|