ID: 951283467_951283475

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 951283467 951283475
Species Human (GRCh38) Human (GRCh38)
Location 3:20780371-20780393 3:20780410-20780432
Sequence CCCCAGAGCCATAGTAGGCAGCC TGAACTACAGCCGGGACTCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 203} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!