|
Left Crispr |
Right Crispr |
| Crispr ID |
951404812 |
951404816 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:22282913-22282935
|
3:22282960-22282982
|
| Sequence |
CCAATCAAGTATCTGCTATCTTC |
ACTCATAAACTTAAGGTAAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 29, 2: 181, 3: 359, 4: 560} |
{0: 3, 1: 13, 2: 356, 3: 517, 4: 797} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|