ID: 951404813_951404816

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 951404813 951404816
Species Human (GRCh38) Human (GRCh38)
Location 3:22282946-22282968 3:22282960-22282982
Sequence CCTGACATATAAGAACTCATAAA ACTCATAAACTTAAGGTAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 65, 4: 576} {0: 3, 1: 13, 2: 356, 3: 517, 4: 797}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!