|
Left Crispr |
Right Crispr |
| Crispr ID |
951970759 |
951970766 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:28441847-28441869
|
3:28441895-28441917
|
| Sequence |
CCACCAAAGCCCAGTAACAGACC |
AGTTATCTGCAGAAGATGGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 17, 1: 155, 2: 153, 3: 106, 4: 231} |
{0: 185, 1: 187, 2: 104, 3: 111, 4: 225} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|