|
Left Crispr |
Right Crispr |
| Crispr ID |
951970762 |
951970767 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:28441857-28441879
|
3:28441896-28441918
|
| Sequence |
CCAGTAACAGACCAAGAGCTGTC |
GTTATCTGCAGAAGATGGCAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 13, 1: 174, 2: 196, 3: 141, 4: 196} |
{0: 180, 1: 172, 2: 120, 3: 86, 4: 284} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|