|
Left Crispr |
Right Crispr |
| Crispr ID |
952921710 |
952921717 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:38289740-38289762
|
3:38289782-38289804
|
| Sequence |
CCAGATCCGGAGGGGTGGAAGTC |
CGACAAACAGCAGTGGTGGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 31, 1: 87, 2: 117, 3: 65, 4: 76} |
{0: 2, 1: 66, 2: 128, 3: 75, 4: 167} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|