|
Left Crispr |
Right Crispr |
| Crispr ID |
952922689 |
952922699 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:38296882-38296904
|
3:38296929-38296951
|
| Sequence |
CCCTGCCAGATTCGGAGGGGTGG |
CGACAAACAGCAGTGGTGGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 14, 2: 60, 3: 122, 4: 236} |
{0: 2, 1: 66, 2: 128, 3: 75, 4: 167} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|