ID: 952971530_952971537

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 952971530 952971537
Species Human (GRCh38) Human (GRCh38)
Location 3:38653828-38653850 3:38653866-38653888
Sequence CCTGCCTCATGCAGATGGCTATC GAGGGCATCTGGCACAGTGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!