ID: 953246592_953246602

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 953246592 953246602
Species Human (GRCh38) Human (GRCh38)
Location 3:41199382-41199404 3:41199401-41199423
Sequence CCACCGCCCCCTCGCGCCCCGCC CGCCCCTTGTCCTCGCGCGGCGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 22, 3: 302, 4: 2098} {0: 1, 1: 0, 2: 0, 3: 5, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!