ID: 953246596_953246613

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 953246596 953246613
Species Human (GRCh38) Human (GRCh38)
Location 3:41199390-41199412 3:41199440-41199462
Sequence CCCTCGCGCCCCGCCCCTTGTCC CCGGTGGCGGCAGGATACAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 67, 4: 627} {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!