ID: 953246600_953246608

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 953246600 953246608
Species Human (GRCh38) Human (GRCh38)
Location 3:41199399-41199421 3:41199424-41199446
Sequence CCCGCCCCTTGTCCTCGCGCGGC AACGCTCCGCGCTGCGCCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 168} {0: 1, 1: 0, 2: 0, 3: 0, 4: 25}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!