|
Left Crispr |
Right Crispr |
| Crispr ID |
953515821 |
953515831 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:43591187-43591209
|
3:43591234-43591256
|
| Sequence |
CCATCCACCACTGCTGTTCGCCG |
CCATCCCTCCAGATCAGGCAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 75, 2: 141, 3: 72, 4: 114} |
{0: 4, 1: 33, 2: 76, 3: 174, 4: 324} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|