|
Left Crispr |
Right Crispr |
| Crispr ID |
953599415 |
953599419 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:44348382-44348404
|
3:44348396-44348418
|
| Sequence |
CCGATTTCCAGTGGGGTCCCACA |
GGTCCCACACAGATGGGACACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 60, 1: 316, 2: 209, 3: 115, 4: 148} |
{0: 82, 1: 298, 2: 258, 3: 133, 4: 248} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|