ID: 953810109_953810115

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 953810109 953810115
Species Human (GRCh38) Human (GRCh38)
Location 3:46104867-46104889 3:46104898-46104920
Sequence CCCACTGCTTCTTGTTCTGCAGG TTCTAGGTGGCCAGACTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 260} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!