|
Left Crispr |
Right Crispr |
| Crispr ID |
954054152 |
954054157 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:48007925-48007947
|
3:48007968-48007990
|
| Sequence |
CCTCCCAAAGTGCTGATTACAGC |
GTCAGCTCTTGGCCTGTTACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 60, 2: 109, 3: 220, 4: 582} |
{0: 3, 1: 173, 2: 187, 3: 145, 4: 189} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|