ID: 954108710_954108719

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 954108710 954108719
Species Human (GRCh38) Human (GRCh38)
Location 3:48422629-48422651 3:48422661-48422683
Sequence CCCAGTCCTGGGGAGAGGAGCTC CTCCTGGCCCAGGGGTCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 28, 4: 259} {0: 1, 1: 0, 2: 2, 3: 34, 4: 346}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!