ID: 954108713_954108725

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 954108713 954108725
Species Human (GRCh38) Human (GRCh38)
Location 3:48422635-48422657 3:48422681-48422703
Sequence CCTGGGGAGAGGAGCTCAGGTCA GGGATAGCTTAAACCAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 328} {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!