ID: 954176217_954176230

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 954176217 954176230
Species Human (GRCh38) Human (GRCh38)
Location 3:48847761-48847783 3:48847805-48847827
Sequence CCCTACGCTACCACGGCCGACCT GGGCAGCCGCCGCCGCCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 16} {0: 1, 1: 0, 2: 12, 3: 119, 4: 632}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!