ID: 954176218_954176230

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 954176218 954176230
Species Human (GRCh38) Human (GRCh38)
Location 3:48847762-48847784 3:48847805-48847827
Sequence CCTACGCTACCACGGCCGACCTG GGGCAGCCGCCGCCGCCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 36} {0: 1, 1: 0, 2: 12, 3: 119, 4: 632}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!