ID: 954176221_954176232

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 954176221 954176232
Species Human (GRCh38) Human (GRCh38)
Location 3:48847777-48847799 3:48847813-48847835
Sequence CCGACCTGGCACCGCCGCCGCTG GCCGCCGCCGCGGGGACCGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 201} {0: 1, 1: 1, 2: 1, 3: 24, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!