ID: 954598563_954598564

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 954598563 954598564
Species Human (GRCh38) Human (GRCh38)
Location 3:51850033-51850055 3:51850058-51850080
Sequence CCTAGCTAAAGGTTTGTAAACAC CAATCAGCACTCTGTAAAAACGG
Strand - +
Off-target summary {0: 3, 1: 18, 2: 25, 3: 69, 4: 194} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!