ID: 955701466_955701474

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 955701466 955701474
Species Human (GRCh38) Human (GRCh38)
Location 3:61686040-61686062 3:61686073-61686095
Sequence CCGTGAGGAGCACTTGGTGCTCG CCCGTGGTCTTGCGTGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76} {0: 1, 1: 0, 2: 0, 3: 1, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!