ID: 956202628_956202635

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 956202628 956202635
Species Human (GRCh38) Human (GRCh38)
Location 3:66722296-66722318 3:66722341-66722363
Sequence CCTTCTTTCTTCTTCCATCCTCC CTCTTCTTCTTTTTTAGAGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 10, 3: 231, 4: 3127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!