ID: 956360449_956360453

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 956360449 956360453
Species Human (GRCh38) Human (GRCh38)
Location 3:68441408-68441430 3:68441446-68441468
Sequence CCTGCCATCTTCTGCAGATTACT GATAGCTCTTGGCCTGTTACTGG
Strand - +
Off-target summary {0: 2, 1: 189, 2: 186, 3: 113, 4: 268} {0: 2, 1: 176, 2: 216, 3: 136, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!