|
Left Crispr |
Right Crispr |
Crispr ID |
956360449 |
956360453 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:68441408-68441430
|
3:68441446-68441468
|
Sequence |
CCTGCCATCTTCTGCAGATTACT |
GATAGCTCTTGGCCTGTTACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 189, 2: 186, 3: 113, 4: 268} |
{0: 2, 1: 176, 2: 216, 3: 136, 4: 167} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|